Search Results for ''

published presentations and documents on DocSlides.

Genome alignment Usman Roshan

Genome alignment Usman Roshan

by okelly

Applications. Genome sequencing on the rise. Whole...

Algorithms: Alignment & Variant Calling

Algorithms: Alignment & Variant Calling

by olivia-moreira

BIOS 234. June 1. Variant Detection Pipeline. Ali...

Fast and accurate short read alignment with Burrows–Wheel

Fast and accurate short read alignment with Burrows–Wheel

by danika-pritchard

transform. Heng. Li and Richard Durbin∗. Membe...

Reference genome assemblies and the technology behind them

Reference genome assemblies and the technology behind them

by phoebe-click

Derek M Bickhart . Animal Genomics and Improvemen...

1 Genome sizes (sample)

1 Genome sizes (sample)

by myesha-ticknor

2. Some genomics history. 1995: first bacterial g...

Damla Senol Cali, Ph.D. damlasenolcali@gmail.com

Damla Senol Cali, Ph.D. damlasenolcali@gmail.com

by elizabeth

. https://damlasenolcali.github.io/. . Konstantin...

Damla Senol Cali Carnegie Mellon University

Damla Senol Cali Carnegie Mellon University

by lauren

(. dsenol@andrew.cmu.edu. ). Gurpreet S. Kalsi. 2....

Introduction to Short Read Sequencing Analysis

Introduction to Short Read Sequencing Analysis

by sherrill-nordquist

Jim Noonan. GENE 760. Sequence read lengths remai...

Sequence Comparison and

Sequence Comparison and

by cheryl-pisano

Genome Alignment in the Human Genome. Jian. Ma....

Introduction to Short

Introduction to Short

by lindy-dunigan

Read Sequencing . Analysis. Jim Noonan. GENE 760....

by phoebe-click

Comparative Genomics. Eric Franzosa, PhD. 2 April...

Damla Senol Cali et al.

Damla Senol Cali et al.

by alyssa

https://damlasenolcali.github.io. TECHCON’. 21. ...

From Smith-Waterman to BLAST

From Smith-Waterman to BLAST

by myesha-ticknor

Jeremy Buhler (. in absentia. ). Wilson Leung 07/...

by tatiana-dople

Unveiling . the Transcriptome using . RNA-. seq. ...

Introduction to Short Read Sequencing Analysis

Introduction to Short Read Sequencing Analysis

by stefany-barnette

James Knight. (with many slides adapted from Jim ...

Advancing Genome-Scale Phylogenomic Analysis

Advancing Genome-Scale Phylogenomic Analysis

by stefany-barnette

Tandy Warnow. Departments of Computer Science and...

Dynamic Programming II

Dynamic Programming II

by mitsue-stanley

Dynamic Programming II Gene Prediction: Similari...

Sequence a lignments: Scoring schemes and basic approaches

Sequence a lignments: Scoring schemes and basic approaches

by CherryBlossom

Hardison. Genomics 4_1. Sources: Webb Miller (Penn...

Dynamic Programming II Gene Prediction: Similarity-Based Approaches

Dynamic Programming II Gene Prediction: Similarity-Based Approaches

by finley

The idea of similarity-based approach to gene pred...

P&S Genomics Lecture 8a: GenASM

P&S Genomics Lecture 8a: GenASM

by daisy

Joël Lindegger. ETH Zürich. Spring 2023. 27 Apri...

Genomics and Personalized Care in Health Systems

Genomics and Personalized Care in Health Systems

by lois-ondreau

Lecture 5 Genome Browser. Leming Zhou, PhD. Schoo...

Previous Lecture:

Previous Lecture:

by liane-varnes

Gene Expression . Next-Generation . DNA Sequencin...

by stefany-barnette

:. . Unbiased Probabilistic Mapping of Next-Gene...

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

by luanne-stotts

TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...

Mapping NGS sequences to a reference genome

Mapping NGS sequences to a reference genome

by debby-jeon

Why?. Resequencing. studies (DNA). Structural va...

Last lecture summary

Last lecture summary

by briana-ranney

Sequencing strategies. Hierarchical genome shotgu...

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT

by olivia-moreira

TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGC...

UPR - Department of Biology

UPR - Department of Biology

by cadie

College of Natural Resource. Río Piedras Campus. ...

Last lecture summary Sequencing strategies

Last lecture summary Sequencing strategies

by vivian

Hierarchical genome shotgun HGS – Human Genome P...

Bioinformatics Lecture 1

Bioinformatics Lecture 1

by Outlawking

DNA - the basics. Drew Berry – DNA animations. h...

Damla Senol Cali Ph.D. Thesis Defense - July

Damla Senol Cali Ph.D. Thesis Defense - July

by CherryBlossom

15, 2021. dsenol@andrew.cmu.edu. . Commit...

Genome Sciences 373 Genome Informatics

Genome Sciences 373 Genome Informatics

by walsh

Q. uiz Section . 5. April . 28, . 2015. Bonferroni...

Methodologies for Structural Variant detection

Methodologies for Structural Variant detection

by delcy

Fritz . Sedlazeck. Jan,12, 2024. Population. ADSP....

Comparative genomics

Comparative genomics

by olivia-moreira

Joachim Bargsten. February 2012. Comparative . ge...

Genome curation guide Empowering the Medfly community by Alexie Papanicolaou, Monica

Genome curation guide Empowering the Medfly community by Alexie Papanicolaou, Monica

by lois-ondreau

Genome curation guide Empowering the Medfly com...

Next Generation Sequencing,

Next Generation Sequencing,

by myesha-ticknor

Assembly, and Alignment Methods . Andy Nagar. Ag...

RNA-seq: Quantifying the Transcriptome

RNA-seq: Quantifying the Transcriptome

by karlyn-bohler

Alisha Holloway, PhD. Gladstone Bioinformatics Co...

http://cs273a.stanford.edu [Bejerano Fall16/17]

http://cs273a.stanford.edu [Bejerano Fall16/17]

by lindy-dunigan

1. CS273A. Lecture . 14: . Inferring Evolution: C...

Introduction To Next Generation Sequencing (NGS) Data Anal

Introduction To Next Generation Sequencing (NGS) Data Anal

by karlyn-bohler

Jenny . Wu. Outline. Goals : Practical guide to N...

Human SNPs from short reads in hours using cloud computing

Human SNPs from short reads in hours using cloud computing

by phoebe-click

Ben Langmead. 1, 2. , Michael C. Schatz. 2. , Jim...